ID: 1199124490

View in Genome Browser
Species Human (GRCh38)
Location X:144099650-144099672
Sequence CTGTGTGACCAGATGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199124487_1199124490 7 Left 1199124487 X:144099620-144099642 CCAAGGCTACAGTAGTTCTAAAG No data
Right 1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG No data
1199124486_1199124490 8 Left 1199124486 X:144099619-144099641 CCCAAGGCTACAGTAGTTCTAAA No data
Right 1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG No data
1199124485_1199124490 13 Left 1199124485 X:144099614-144099636 CCAGTCCCAAGGCTACAGTAGTT No data
Right 1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199124490 Original CRISPR CTGTGTGACCAGATGGTGCT AGG Intergenic
No off target data available for this crispr