ID: 1199131209

View in Genome Browser
Species Human (GRCh38)
Location X:144188801-144188823
Sequence AAGGCAAGTTACCATTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199131204_1199131209 30 Left 1199131204 X:144188748-144188770 CCAACATGTCAGTATAAAGGGGA No data
Right 1199131209 X:144188801-144188823 AAGGCAAGTTACCATTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199131209 Original CRISPR AAGGCAAGTTACCATTTGGT TGG Intergenic
No off target data available for this crispr