ID: 1199132861

View in Genome Browser
Species Human (GRCh38)
Location X:144213911-144213933
Sequence ATGTTTCAGCTTAATCAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199132861_1199132865 26 Left 1199132861 X:144213911-144213933 CCAGATTGATTAAGCTGAAACAT No data
Right 1199132865 X:144213960-144213982 ACTGAAATATCATTATTCTTGGG No data
1199132861_1199132864 25 Left 1199132861 X:144213911-144213933 CCAGATTGATTAAGCTGAAACAT No data
Right 1199132864 X:144213959-144213981 AACTGAAATATCATTATTCTTGG No data
1199132861_1199132863 -3 Left 1199132861 X:144213911-144213933 CCAGATTGATTAAGCTGAAACAT No data
Right 1199132863 X:144213931-144213953 CATTGGTATTTTCTGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199132861 Original CRISPR ATGTTTCAGCTTAATCAATC TGG (reversed) Intergenic
No off target data available for this crispr