ID: 1199132861 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:144213911-144213933 |
| Sequence | ATGTTTCAGCTTAATCAATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199132861_1199132865 | 26 | Left | 1199132861 | X:144213911-144213933 | CCAGATTGATTAAGCTGAAACAT | No data | ||
| Right | 1199132865 | X:144213960-144213982 | ACTGAAATATCATTATTCTTGGG | No data | ||||
| 1199132861_1199132864 | 25 | Left | 1199132861 | X:144213911-144213933 | CCAGATTGATTAAGCTGAAACAT | No data | ||
| Right | 1199132864 | X:144213959-144213981 | AACTGAAATATCATTATTCTTGG | No data | ||||
| 1199132861_1199132863 | -3 | Left | 1199132861 | X:144213911-144213933 | CCAGATTGATTAAGCTGAAACAT | No data | ||
| Right | 1199132863 | X:144213931-144213953 | CATTGGTATTTTCTGACTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199132861 | Original CRISPR | ATGTTTCAGCTTAATCAATC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||