ID: 1199132864

View in Genome Browser
Species Human (GRCh38)
Location X:144213959-144213981
Sequence AACTGAAATATCATTATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199132861_1199132864 25 Left 1199132861 X:144213911-144213933 CCAGATTGATTAAGCTGAAACAT No data
Right 1199132864 X:144213959-144213981 AACTGAAATATCATTATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199132864 Original CRISPR AACTGAAATATCATTATTCT TGG Intergenic
No off target data available for this crispr