ID: 1199137044

View in Genome Browser
Species Human (GRCh38)
Location X:144265917-144265939
Sequence CATGCCAGTGATGTGATATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199137044_1199137048 -8 Left 1199137044 X:144265917-144265939 CCCCATATCACATCACTGGCATG No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199137044 Original CRISPR CATGCCAGTGATGTGATATG GGG (reversed) Intergenic
No off target data available for this crispr