ID: 1199137048

View in Genome Browser
Species Human (GRCh38)
Location X:144265932-144265954
Sequence CTGGCATGTGAATGTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199137038_1199137048 18 Left 1199137038 X:144265891-144265913 CCAGCACACACTCACCCATAGCC No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data
1199137044_1199137048 -8 Left 1199137044 X:144265917-144265939 CCCCATATCACATCACTGGCATG No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data
1199137043_1199137048 -7 Left 1199137043 X:144265916-144265938 CCCCCATATCACATCACTGGCAT No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data
1199137041_1199137048 -3 Left 1199137041 X:144265912-144265934 CCATCCCCCATATCACATCACTG No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data
1199137039_1199137048 4 Left 1199137039 X:144265905-144265927 CCCATAGCCATCCCCCATATCAC No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data
1199137040_1199137048 3 Left 1199137040 X:144265906-144265928 CCATAGCCATCCCCCATATCACA No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data
1199137046_1199137048 -10 Left 1199137046 X:144265919-144265941 CCATATCACATCACTGGCATGTG No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data
1199137045_1199137048 -9 Left 1199137045 X:144265918-144265940 CCCATATCACATCACTGGCATGT No data
Right 1199137048 X:144265932-144265954 CTGGCATGTGAATGTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199137048 Original CRISPR CTGGCATGTGAATGTGTAGG TGG Intergenic
No off target data available for this crispr