ID: 1199143002

View in Genome Browser
Species Human (GRCh38)
Location X:144334078-144334100
Sequence CGGTATGTACACATGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199142994_1199143002 17 Left 1199142994 X:144334038-144334060 CCCCGGCAACCTTGACAGGTGCT No data
Right 1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG No data
1199143001_1199143002 -8 Left 1199143001 X:144334063-144334085 CCATAGGTACTAATGCGGTATGT No data
Right 1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG No data
1199142995_1199143002 16 Left 1199142995 X:144334039-144334061 CCCGGCAACCTTGACAGGTGCTG No data
Right 1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG No data
1199142996_1199143002 15 Left 1199142996 X:144334040-144334062 CCGGCAACCTTGACAGGTGCTGG No data
Right 1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG No data
1199142991_1199143002 24 Left 1199142991 X:144334031-144334053 CCCTTAGCCCCGGCAACCTTGAC No data
Right 1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG No data
1199142992_1199143002 23 Left 1199142992 X:144334032-144334054 CCTTAGCCCCGGCAACCTTGACA No data
Right 1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG No data
1199142998_1199143002 8 Left 1199142998 X:144334047-144334069 CCTTGACAGGTGCTGGCCATAGG No data
Right 1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199143002 Original CRISPR CGGTATGTACACATGAAGCA AGG Intergenic
No off target data available for this crispr