ID: 1199144115

View in Genome Browser
Species Human (GRCh38)
Location X:144346086-144346108
Sequence AAAGCCTTCTTAAAAAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199144115_1199144119 30 Left 1199144115 X:144346086-144346108 CCCATCTTTTTTAAGAAGGCTTT No data
Right 1199144119 X:144346139-144346161 CTCTTAGCTTGAGTGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199144115 Original CRISPR AAAGCCTTCTTAAAAAAGAT GGG (reversed) Intergenic