ID: 1199144441

View in Genome Browser
Species Human (GRCh38)
Location X:144348959-144348981
Sequence AACAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199144441_1199144446 16 Left 1199144441 X:144348959-144348981 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1199144446 X:144348998-144349020 GGTATCTGAAGAAGATAGCAGGG No data
1199144441_1199144444 -5 Left 1199144441 X:144348959-144348981 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1199144444 X:144348977-144348999 CTGTTTCTCAAAAGGAGATTAGG No data
1199144441_1199144445 15 Left 1199144441 X:144348959-144348981 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199144441 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr