ID: 1199144445

View in Genome Browser
Species Human (GRCh38)
Location X:144348997-144349019
Sequence AGGTATCTGAAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199144441_1199144445 15 Left 1199144441 X:144348959-144348981 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG No data
1199144440_1199144445 16 Left 1199144440 X:144348958-144348980 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG No data
1199144443_1199144445 4 Left 1199144443 X:144348970-144348992 CCAAGAGCTGTTTCTCAAAAGGA No data
Right 1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG No data
1199144439_1199144445 22 Left 1199144439 X:144348952-144348974 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG No data
1199144438_1199144445 25 Left 1199144438 X:144348949-144348971 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199144445 Original CRISPR AGGTATCTGAAGAAGATAGC AGG Intergenic
No off target data available for this crispr