ID: 1199161016

View in Genome Browser
Species Human (GRCh38)
Location X:144611837-144611859
Sequence TGTCCTCTGTTGCCAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199161016_1199161020 23 Left 1199161016 X:144611837-144611859 CCTCCTGTTGGCAACAGAGGACA No data
Right 1199161020 X:144611883-144611905 AGAGCCTAGTTTACATTGATGGG No data
1199161016_1199161021 24 Left 1199161016 X:144611837-144611859 CCTCCTGTTGGCAACAGAGGACA No data
Right 1199161021 X:144611884-144611906 GAGCCTAGTTTACATTGATGGGG No data
1199161016_1199161019 22 Left 1199161016 X:144611837-144611859 CCTCCTGTTGGCAACAGAGGACA No data
Right 1199161019 X:144611882-144611904 AAGAGCCTAGTTTACATTGATGG No data
1199161016_1199161018 -9 Left 1199161016 X:144611837-144611859 CCTCCTGTTGGCAACAGAGGACA No data
Right 1199161018 X:144611851-144611873 CAGAGGACAACATTCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199161016 Original CRISPR TGTCCTCTGTTGCCAACAGG AGG (reversed) Intergenic
No off target data available for this crispr