ID: 1199161018

View in Genome Browser
Species Human (GRCh38)
Location X:144611851-144611873
Sequence CAGAGGACAACATTCTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199161016_1199161018 -9 Left 1199161016 X:144611837-144611859 CCTCCTGTTGGCAACAGAGGACA No data
Right 1199161018 X:144611851-144611873 CAGAGGACAACATTCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199161018 Original CRISPR CAGAGGACAACATTCTTCTG AGG Intergenic
No off target data available for this crispr