ID: 1199161020

View in Genome Browser
Species Human (GRCh38)
Location X:144611883-144611905
Sequence AGAGCCTAGTTTACATTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199161017_1199161020 20 Left 1199161017 X:144611840-144611862 CCTGTTGGCAACAGAGGACAACA No data
Right 1199161020 X:144611883-144611905 AGAGCCTAGTTTACATTGATGGG No data
1199161016_1199161020 23 Left 1199161016 X:144611837-144611859 CCTCCTGTTGGCAACAGAGGACA No data
Right 1199161020 X:144611883-144611905 AGAGCCTAGTTTACATTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199161020 Original CRISPR AGAGCCTAGTTTACATTGAT GGG Intergenic
No off target data available for this crispr