ID: 1199162091

View in Genome Browser
Species Human (GRCh38)
Location X:144624829-144624851
Sequence ATCAGAAATGTCTCCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199162091_1199162094 17 Left 1199162091 X:144624829-144624851 CCCTGTCTGGAGACATTTCTGAT No data
Right 1199162094 X:144624869-144624891 GTACTGTTACTTATATCAATTGG No data
1199162091_1199162093 -10 Left 1199162091 X:144624829-144624851 CCCTGTCTGGAGACATTTCTGAT No data
Right 1199162093 X:144624842-144624864 CATTTCTGATTTTCACAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199162091 Original CRISPR ATCAGAAATGTCTCCAGACA GGG (reversed) Intergenic
No off target data available for this crispr