ID: 1199171097

View in Genome Browser
Species Human (GRCh38)
Location X:144735071-144735093
Sequence CTGGTCCTGCCGTTGACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199171092_1199171097 -1 Left 1199171092 X:144735049-144735071 CCCATTATCCAATTATCTTCACC No data
Right 1199171097 X:144735071-144735093 CTGGTCCTGCCGTTGACACGTGG No data
1199171091_1199171097 4 Left 1199171091 X:144735044-144735066 CCACACCCATTATCCAATTATCT No data
Right 1199171097 X:144735071-144735093 CTGGTCCTGCCGTTGACACGTGG No data
1199171095_1199171097 -9 Left 1199171095 X:144735057-144735079 CCAATTATCTTCACCTGGTCCTG No data
Right 1199171097 X:144735071-144735093 CTGGTCCTGCCGTTGACACGTGG No data
1199171093_1199171097 -2 Left 1199171093 X:144735050-144735072 CCATTATCCAATTATCTTCACCT No data
Right 1199171097 X:144735071-144735093 CTGGTCCTGCCGTTGACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199171097 Original CRISPR CTGGTCCTGCCGTTGACACG TGG Intergenic
No off target data available for this crispr