ID: 1199171929

View in Genome Browser
Species Human (GRCh38)
Location X:144742969-144742991
Sequence TAGGGTTAACAGGCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199171917_1199171929 19 Left 1199171917 X:144742927-144742949 CCTTTCCCCTGCCCCAAACTGAA No data
Right 1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG No data
1199171922_1199171929 8 Left 1199171922 X:144742938-144742960 CCCCAAACTGAAAGGCAATTAAA No data
Right 1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG No data
1199171923_1199171929 7 Left 1199171923 X:144742939-144742961 CCCAAACTGAAAGGCAATTAAAA No data
Right 1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG No data
1199171920_1199171929 13 Left 1199171920 X:144742933-144742955 CCCTGCCCCAAACTGAAAGGCAA No data
Right 1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG No data
1199171921_1199171929 12 Left 1199171921 X:144742934-144742956 CCTGCCCCAAACTGAAAGGCAAT No data
Right 1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG No data
1199171919_1199171929 14 Left 1199171919 X:144742932-144742954 CCCCTGCCCCAAACTGAAAGGCA No data
Right 1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG No data
1199171924_1199171929 6 Left 1199171924 X:144742940-144742962 CCAAACTGAAAGGCAATTAAAAG No data
Right 1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199171929 Original CRISPR TAGGGTTAACAGGCTGTTGC AGG Intergenic
No off target data available for this crispr