ID: 1199172375

View in Genome Browser
Species Human (GRCh38)
Location X:144746251-144746273
Sequence TGGAGTCAATCCAGAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199172375_1199172378 15 Left 1199172375 X:144746251-144746273 CCAGCAGTTCTGGATTGACTCCA No data
Right 1199172378 X:144746289-144746311 TAAATGCCATCAGTATACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199172375 Original CRISPR TGGAGTCAATCCAGAACTGC TGG (reversed) Intergenic
No off target data available for this crispr