ID: 1199178729

View in Genome Browser
Species Human (GRCh38)
Location X:144825815-144825837
Sequence ATTGAAAAGCAGAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199178729_1199178731 8 Left 1199178729 X:144825815-144825837 CCATCTTCTTTCTGCTTTTCAAT No data
Right 1199178731 X:144825846-144825868 GTGAGAACATGGTACTTGAGTGG No data
1199178729_1199178732 14 Left 1199178729 X:144825815-144825837 CCATCTTCTTTCTGCTTTTCAAT No data
Right 1199178732 X:144825852-144825874 ACATGGTACTTGAGTGGCTGAGG No data
1199178729_1199178730 -3 Left 1199178729 X:144825815-144825837 CCATCTTCTTTCTGCTTTTCAAT No data
Right 1199178730 X:144825835-144825857 AATGTGTTTGTGTGAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199178729 Original CRISPR ATTGAAAAGCAGAAAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr