ID: 1199182832

View in Genome Browser
Species Human (GRCh38)
Location X:144878699-144878721
Sequence TCTGCTTCTCCTCACTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199182830_1199182832 10 Left 1199182830 X:144878666-144878688 CCTTTTTTTTTTTTTTTAACATA 0: 6
1: 99
2: 843
3: 5188
4: 18747
Right 1199182832 X:144878699-144878721 TCTGCTTCTCCTCACTATGCAGG No data
1199182829_1199182832 15 Left 1199182829 X:144878661-144878683 CCACTCCTTTTTTTTTTTTTTTA 0: 10
1: 434
2: 4807
3: 28187
4: 88405
Right 1199182832 X:144878699-144878721 TCTGCTTCTCCTCACTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199182832 Original CRISPR TCTGCTTCTCCTCACTATGC AGG Intergenic
No off target data available for this crispr