ID: 1199188083

View in Genome Browser
Species Human (GRCh38)
Location X:144939800-144939822
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199188083_1199188090 28 Left 1199188083 X:144939800-144939822 CCTGAAGGAGCAAGGGGATAGTC No data
Right 1199188090 X:144939851-144939873 CCTGGATCCACAGCTGTAGCAGG No data
1199188083_1199188088 10 Left 1199188083 X:144939800-144939822 CCTGAAGGAGCAAGGGGATAGTC No data
Right 1199188088 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
1199188083_1199188091 29 Left 1199188083 X:144939800-144939822 CCTGAAGGAGCAAGGGGATAGTC No data
Right 1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199188083 Original CRISPR GACTATCCCCTTGCTCCTTC AGG (reversed) Intergenic
No off target data available for this crispr