ID: 1199188087

View in Genome Browser
Species Human (GRCh38)
Location X:144939833-144939855
Sequence CCAGGCATCTCTGTACTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199188087_1199188094 16 Left 1199188087 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
Right 1199188094 X:144939872-144939894 GGGCAGCTGCAGCTGCACCTGGG No data
1199188087_1199188095 20 Left 1199188087 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
Right 1199188095 X:144939876-144939898 AGCTGCAGCTGCACCTGGGATGG 0: 15
1: 44
2: 82
3: 229
4: 699
1199188087_1199188090 -5 Left 1199188087 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
Right 1199188090 X:144939851-144939873 CCTGGATCCACAGCTGTAGCAGG No data
1199188087_1199188091 -4 Left 1199188087 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
Right 1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG No data
1199188087_1199188096 24 Left 1199188087 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
Right 1199188096 X:144939880-144939902 GCAGCTGCACCTGGGATGGCAGG No data
1199188087_1199188093 15 Left 1199188087 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
Right 1199188093 X:144939871-144939893 AGGGCAGCTGCAGCTGCACCTGG 0: 5
1: 32
2: 88
3: 197
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199188087 Original CRISPR CCAGGCATCTCTGTACTTTT AGG (reversed) Intergenic
No off target data available for this crispr