ID: 1199188091

View in Genome Browser
Species Human (GRCh38)
Location X:144939852-144939874
Sequence CTGGATCCACAGCTGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199188085_1199188091 4 Left 1199188085 X:144939825-144939847 CCCAGGTGCCTAAAAGTACAGAG No data
Right 1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG No data
1199188086_1199188091 3 Left 1199188086 X:144939826-144939848 CCAGGTGCCTAAAAGTACAGAGA No data
Right 1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG No data
1199188083_1199188091 29 Left 1199188083 X:144939800-144939822 CCTGAAGGAGCAAGGGGATAGTC No data
Right 1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG No data
1199188087_1199188091 -4 Left 1199188087 X:144939833-144939855 CCTAAAAGTACAGAGATGCCTGG No data
Right 1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199188091 Original CRISPR CTGGATCCACAGCTGTAGCA GGG Intergenic
No off target data available for this crispr