ID: 1199191631

View in Genome Browser
Species Human (GRCh38)
Location X:144978303-144978325
Sequence TTCGGTTCACACTTCTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199191626_1199191631 20 Left 1199191626 X:144978260-144978282 CCTAGGGATGGTTAAAATGAAAG No data
Right 1199191631 X:144978303-144978325 TTCGGTTCACACTTCTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199191631 Original CRISPR TTCGGTTCACACTTCTGGAA TGG Intergenic
No off target data available for this crispr