ID: 1199193761

View in Genome Browser
Species Human (GRCh38)
Location X:145003102-145003124
Sequence TTTTTTGGAGGTTCCCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199193756_1199193761 1 Left 1199193756 X:145003078-145003100 CCTGGATGAGCCTTTTTAAGCTA No data
Right 1199193761 X:145003102-145003124 TTTTTTGGAGGTTCCCTGTAGGG No data
1199193758_1199193761 -9 Left 1199193758 X:145003088-145003110 CCTTTTTAAGCTAATTTTTTGGA No data
Right 1199193761 X:145003102-145003124 TTTTTTGGAGGTTCCCTGTAGGG No data
1199193754_1199193761 20 Left 1199193754 X:145003059-145003081 CCAGCTCTTATACGCATTTCCTG No data
Right 1199193761 X:145003102-145003124 TTTTTTGGAGGTTCCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199193761 Original CRISPR TTTTTTGGAGGTTCCCTGTA GGG Intergenic
No off target data available for this crispr