ID: 1199193840

View in Genome Browser
Species Human (GRCh38)
Location X:145003745-145003767
Sequence CTGAAGATGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199193833_1199193840 7 Left 1199193833 X:145003715-145003737 CCAGCCTCCTTAGATTTTTTTAT No data
Right 1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG No data
1199193832_1199193840 30 Left 1199193832 X:145003692-145003714 CCTTCAAGGGTTTTGAGTCATTA No data
Right 1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG No data
1199193835_1199193840 0 Left 1199193835 X:145003722-145003744 CCTTAGATTTTTTTATCTTGACA No data
Right 1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG No data
1199193834_1199193840 3 Left 1199193834 X:145003719-145003741 CCTCCTTAGATTTTTTTATCTTG No data
Right 1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199193840 Original CRISPR CTGAAGATGGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr