ID: 1199194077

View in Genome Browser
Species Human (GRCh38)
Location X:145006431-145006453
Sequence AGAGACAAGCAGAATGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199194073_1199194077 20 Left 1199194073 X:145006388-145006410 CCATGCATAGGGTGTGTGGAGGG No data
Right 1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199194077 Original CRISPR AGAGACAAGCAGAATGAAGA CGG Intergenic
No off target data available for this crispr