ID: 1199194820

View in Genome Browser
Species Human (GRCh38)
Location X:145015994-145016016
Sequence GCTGAATTGCTAGTTTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199194820_1199194824 17 Left 1199194820 X:145015994-145016016 CCAAATCAAACTAGCAATTCAGC No data
Right 1199194824 X:145016034-145016056 CTTTTATTCCACAGGTTTCCTGG No data
1199194820_1199194821 -7 Left 1199194820 X:145015994-145016016 CCAAATCAAACTAGCAATTCAGC No data
Right 1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG No data
1199194820_1199194825 18 Left 1199194820 X:145015994-145016016 CCAAATCAAACTAGCAATTCAGC No data
Right 1199194825 X:145016035-145016057 TTTTATTCCACAGGTTTCCTGGG No data
1199194820_1199194823 9 Left 1199194820 X:145015994-145016016 CCAAATCAAACTAGCAATTCAGC No data
Right 1199194823 X:145016026-145016048 CTATAGGACTTTTATTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199194820 Original CRISPR GCTGAATTGCTAGTTTGATT TGG (reversed) Intergenic
No off target data available for this crispr