ID: 1199194821

View in Genome Browser
Species Human (GRCh38)
Location X:145016010-145016032
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199194820_1199194821 -7 Left 1199194820 X:145015994-145016016 CCAAATCAAACTAGCAATTCAGC No data
Right 1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG No data
1199194819_1199194821 5 Left 1199194819 X:145015982-145016004 CCATAGGAGATACCAAATCAAAC No data
Right 1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199194821 Original CRISPR ATTCAGCAGCACCATGCTAT AGG Intergenic