ID: 1199194821 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:145016010-145016032 |
| Sequence | ATTCAGCAGCACCATGCTAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199194820_1199194821 | -7 | Left | 1199194820 | X:145015994-145016016 | CCAAATCAAACTAGCAATTCAGC | No data | ||
| Right | 1199194821 | X:145016010-145016032 | ATTCAGCAGCACCATGCTATAGG | No data | ||||
| 1199194819_1199194821 | 5 | Left | 1199194819 | X:145015982-145016004 | CCATAGGAGATACCAAATCAAAC | No data | ||
| Right | 1199194821 | X:145016010-145016032 | ATTCAGCAGCACCATGCTATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199194821 | Original CRISPR | ATTCAGCAGCACCATGCTAT AGG | Intergenic | ||