ID: 1199202110

View in Genome Browser
Species Human (GRCh38)
Location X:145103826-145103848
Sequence TTATCAGGGCCCCGAAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199202110_1199202115 -6 Left 1199202110 X:145103826-145103848 CCTAAGTTTCGGGGCCCTGATAA No data
Right 1199202115 X:145103843-145103865 TGATAAGTGGATGAATAGGATGG No data
1199202110_1199202117 24 Left 1199202110 X:145103826-145103848 CCTAAGTTTCGGGGCCCTGATAA No data
Right 1199202117 X:145103873-145103895 TACGAAGAAGAAAAACAGTGAGG No data
1199202110_1199202112 -10 Left 1199202110 X:145103826-145103848 CCTAAGTTTCGGGGCCCTGATAA No data
Right 1199202112 X:145103839-145103861 GCCCTGATAAGTGGATGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199202110 Original CRISPR TTATCAGGGCCCCGAAACTT AGG (reversed) Intergenic
No off target data available for this crispr