ID: 1199204143

View in Genome Browser
Species Human (GRCh38)
Location X:145128089-145128111
Sequence TCGAATATACAAACAGACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199204142_1199204143 -1 Left 1199204142 X:145128067-145128089 CCATTTGTTTCAAGCAGAGAAAT No data
Right 1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG No data
1199204141_1199204143 0 Left 1199204141 X:145128066-145128088 CCCATTTGTTTCAAGCAGAGAAA No data
Right 1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG No data
1199204140_1199204143 29 Left 1199204140 X:145128037-145128059 CCTTTTCTTATGGGAAATGGGCA No data
Right 1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199204143 Original CRISPR TCGAATATACAAACAGACAA CGG Intergenic
No off target data available for this crispr