ID: 1199208138

View in Genome Browser
Species Human (GRCh38)
Location X:145173671-145173693
Sequence AAAAGTCCTCAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199208135_1199208138 -9 Left 1199208135 X:145173657-145173679 CCCTGGAGAAGCATAAAAGTCCT No data
Right 1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG No data
1199208136_1199208138 -10 Left 1199208136 X:145173658-145173680 CCTGGAGAAGCATAAAAGTCCTC No data
Right 1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG No data
1199208134_1199208138 2 Left 1199208134 X:145173646-145173668 CCGGGGTTATACCCTGGAGAAGC No data
Right 1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG No data
1199208133_1199208138 3 Left 1199208133 X:145173645-145173667 CCCGGGGTTATACCCTGGAGAAG No data
Right 1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199208138 Original CRISPR AAAAGTCCTCAGATGGAGCA AGG Intergenic
No off target data available for this crispr