ID: 1199213571

View in Genome Browser
Species Human (GRCh38)
Location X:145242298-145242320
Sequence GGGGCTGGTGGTAGACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199213565_1199213571 -8 Left 1199213565 X:145242283-145242305 CCCCCAAGGGCATACGGGGCTGG No data
Right 1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG No data
1199213568_1199213571 -10 Left 1199213568 X:145242285-145242307 CCCAAGGGCATACGGGGCTGGTG No data
Right 1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG No data
1199213567_1199213571 -9 Left 1199213567 X:145242284-145242306 CCCCAAGGGCATACGGGGCTGGT No data
Right 1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG No data
1199213560_1199213571 5 Left 1199213560 X:145242270-145242292 CCAGGAGTTTCATCCCCCAAGGG No data
Right 1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199213571 Original CRISPR GGGGCTGGTGGTAGACAGCT TGG Intergenic
No off target data available for this crispr