ID: 1199213759

View in Genome Browser
Species Human (GRCh38)
Location X:145244167-145244189
Sequence GCTCACAGGAAGCCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199213759_1199213762 1 Left 1199213759 X:145244167-145244189 CCTGGCTGTGGCTTCCTGTGAGC No data
Right 1199213762 X:145244191-145244213 GATCTATTAGGCAGTAGTTGAGG No data
1199213759_1199213763 28 Left 1199213759 X:145244167-145244189 CCTGGCTGTGGCTTCCTGTGAGC No data
Right 1199213763 X:145244218-145244240 CACTTACCCTGAATTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199213759 Original CRISPR GCTCACAGGAAGCCACAGCC AGG (reversed) Intergenic
No off target data available for this crispr