ID: 1199215021

View in Genome Browser
Species Human (GRCh38)
Location X:145253144-145253166
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 3, 1: 2, 2: 4, 3: 13, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900614792 1:3560678-3560700 TGGAAACCACAGATGGGGAGGGG - Intronic
901950873 1:12745172-12745194 CAGAGACCACAGTTGGGGCAGGG - Intergenic
902041390 1:13495082-13495104 CTGAGACCACAGAAGGGTCAGGG + Intronic
903907841 1:26697975-26697997 TTGAAAGCACAGATGGGGGGCGG - Intronic
905830910 1:41066661-41066683 TTGATTCCAGGGATGGGGCAGGG - Intronic
910123601 1:83817067-83817089 TTGGTTCCGCAGATGGGCCAGGG - Intergenic
911482763 1:98464989-98465011 TTGACACCAAAGATGGGGGGTGG + Intergenic
912194594 1:107382576-107382598 ATGATACAACAGATAGGACATGG - Intronic
912788335 1:112625909-112625931 TTGAGGCCAGAGATGTGGCAAGG - Intronic
912903238 1:113675391-113675413 TTCGTAGTACAGATGGGGCAAGG - Intronic
913203406 1:116514267-116514289 TGTATAACACAGGTGGGGCAGGG - Intergenic
914826665 1:151142463-151142485 TTGTTCACAGAGATGGGGCAAGG + Intronic
917801374 1:178573559-178573581 TTCAAACCACAGATAGAGCAGGG - Intergenic
918460141 1:184767995-184768017 TTTTTTCCACGGATGGGGCAGGG - Intergenic
918951902 1:191151014-191151036 TTGTTACCAAAAATGGCGCAGGG - Intergenic
919344948 1:196363364-196363386 TTGATTCCAGGAATGGGGCAGGG - Intronic
921690085 1:218138626-218138648 TTGACTCCAGAGATGGGGCTTGG - Intergenic
922322945 1:224503725-224503747 TTGAAAACACAGCTGTGGCAAGG + Intronic
1063857641 10:10272611-10272633 TTGATTCCAAGGATGGGGCAGGG + Intergenic
1064024320 10:11834763-11834785 TTGATACCACAGGCCAGGCAAGG - Intronic
1065049538 10:21777895-21777917 TTGATATCACAGGCTGGGCATGG + Intronic
1065822657 10:29540228-29540250 GTGAGACCACAGATCGGGGAGGG - Intronic
1073134113 10:101210449-101210471 TTTCTTCCAAAGATGGGGCAGGG - Intergenic
1073675926 10:105646989-105647011 TGGATTCCACAGATGGGGAAAGG + Intergenic
1075776735 10:124993975-124993997 TTCCTTCCACAGATGAGGCAGGG - Exonic
1077619758 11:3710146-3710168 TAGATTCCACAGATTTGGCATGG - Intronic
1078459036 11:11499434-11499456 TTGAGCCCACAGGTGGGGGAGGG - Intronic
1078499173 11:11852519-11852541 TTGATTCCAGGGTTGGGGCAAGG - Intronic
1078503076 11:11902813-11902835 TTGAAACCACAGATGTTACAAGG + Exonic
1079465884 11:20730537-20730559 TTGATACCACACCTTGGGCTTGG + Intronic
1080868979 11:36220416-36220438 TTGATTCCCCAGATGAGGGAGGG - Intronic
1081503661 11:43692457-43692479 CTGATACCACAGATGAAGAAAGG - Intronic
1084214647 11:67640755-67640777 TTGATTCCTAAGAGGGGGCATGG + Intergenic
1084883542 11:72188998-72189020 GTGGTACCACAGATGGGAAAAGG - Intergenic
1084970863 11:72771391-72771413 CTGAGTCCAAAGATGGGGCAAGG - Intronic
1087307232 11:96501548-96501570 TTGATACCACAGATGGGGCAAGG - Intronic
1087534846 11:99430164-99430186 TTGATACCAAAGATGGTAAAGGG + Intronic
1088177199 11:107066902-107066924 TTGATACCATGGATGCGTCAGGG - Intergenic
1090633844 11:128675605-128675627 TTGATTCCAGGGCTGGGGCAGGG + Intergenic
1092895302 12:13004569-13004591 TTCTTACCACACATGGGGAAGGG + Intergenic
1093179698 12:15953078-15953100 TGGTCACCACAGATGGGGTAGGG - Intronic
1094399292 12:30044389-30044411 TGGAAACCACAGAAGGAGCACGG + Intergenic
1095252265 12:39992396-39992418 TTACTACCACAGAGGTGGCAGGG + Intronic
1095773167 12:45985042-45985064 TTGATTCCAGTGCTGGGGCAGGG - Intronic
1096258027 12:50074576-50074598 TTGACCTCACAGATGGAGCAAGG - Intronic
1096281312 12:50256739-50256761 TTGATTCCAGAGCTGGGGAAGGG + Intronic
1096519831 12:52178686-52178708 CTGATACCACAGCCTGGGCAAGG - Intronic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1099016035 12:77345368-77345390 TTGATAGCCCAAATGGGGCTTGG + Intergenic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1099466164 12:82990654-82990676 TTGACACTAGATATGGGGCAGGG + Intronic
1102580484 12:113883355-113883377 TTGATGCCACATGTGGGTCAGGG + Intronic
1105718701 13:23092832-23092854 TTGTTTCCACAAATGGGGCTCGG - Intergenic
1107861768 13:44667619-44667641 TGGCTCTCACAGATGGGGCAGGG + Intergenic
1110177465 13:72574116-72574138 TTACTAGCCCAGATGGGGCAGGG + Intergenic
1110471613 13:75866366-75866388 TAGATGCCACCGATGGGGGAAGG - Intergenic
1112648546 13:101364561-101364583 TTGTTACCAGAGAAGGGGAAGGG + Intronic
1114616671 14:24072138-24072160 TTGGTACCACTGCTGGGGGAAGG + Intronic
1115186732 14:30697197-30697219 CTGATTCCAGAGGTGGGGCAGGG + Intronic
1117128743 14:52662627-52662649 TTCATATTACAGATGGGGTAGGG + Intronic
1117585727 14:57201186-57201208 CTGATTCCAGAGCTGGGGCAAGG + Exonic
1122112807 14:99513824-99513846 TTGATCCCACAGCTGCAGCACGG - Exonic
1124372358 15:29110949-29110971 TAGCTCCCAAAGATGGGGCAAGG + Intronic
1125558238 15:40604060-40604082 TTGACTCCACAGGTGGGGCTTGG - Intronic
1126354642 15:47782477-47782499 TGGAAACAACAGATGGTGCATGG + Intergenic
1126684105 15:51232305-51232327 CAAATACCACTGATGGGGCAAGG - Intronic
1128434847 15:67636661-67636683 TGGATACCAGACATGTGGCATGG + Intronic
1128979183 15:72174468-72174490 TGAATTCCACAGCTGGGGCATGG - Intronic
1129047921 15:72753225-72753247 CTCTTACCACTGATGGGGCATGG + Intronic
1129331766 15:74831500-74831522 CTGAGACCACAGGTGGGGCCGGG + Exonic
1132725090 16:1334944-1334966 TTCTTACCACATTTGGGGCAGGG - Intronic
1133830764 16:9321402-9321424 TTGTGAGCACAGGTGGGGCAAGG + Intergenic
1134016339 16:10891153-10891175 GTGGTATCACAGATGGGGGATGG - Intronic
1136036795 16:27546731-27546753 CAGATAACACAGAGGGGGCAAGG - Intronic
1139304319 16:65970290-65970312 TGGATACCAGAGATGGGGCAGGG - Intergenic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1145036360 17:19543451-19543473 TTGGTCCCACAGTTGGGGGAGGG + Intronic
1148334775 17:46833900-46833922 TTGATACCTGGGATGGGACATGG - Intronic
1150379551 17:64709823-64709845 CTAATACCACAGATGGGGAAGGG - Intergenic
1150998375 17:70345535-70345557 TTGATTTCAAAGATTGGGCATGG + Intergenic
1152532913 17:80930823-80930845 TTCCTCCCACAGCTGGGGCAGGG + Intronic
1153066303 18:1049040-1049062 TGGATACCACAGATTGGGAAAGG - Intergenic
1155107720 18:22684126-22684148 CTGATCCCACAGAAGGGACAAGG + Intergenic
1157930793 18:51820801-51820823 TGCATATCACAGATTGGGCACGG - Intergenic
1158539945 18:58344243-58344265 CTGATACCACACAATGGGCAAGG - Intronic
1158700089 18:59737688-59737710 AAGATACCACAGATGGGGACAGG + Intergenic
1158807640 18:60994171-60994193 CTGATTCTACAGCTGGGGCAAGG - Intergenic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1165385705 19:35509679-35509701 CTTATACCACAGATGGGGCTGGG - Intronic
1166404600 19:42511074-42511096 TTAGTACCAGAGAGGGGGCAGGG + Intronic
1168593245 19:57653823-57653845 TTGATACCACAGATGGGGCAAGG - Intergenic
928326703 2:30324927-30324949 ATGAGACCCCAGATTGGGCACGG + Intergenic
929957333 2:46468296-46468318 TTGATCCCAGAGATGGGGTCTGG - Intronic
930127365 2:47812126-47812148 TTGAGGCTACAGAAGGGGCAAGG - Intronic
932490834 2:72119204-72119226 TTGAAACCCCAGTTAGGGCATGG - Intergenic
932741892 2:74297271-74297293 TAGATACCTCACATGGTGCATGG - Intronic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
937370470 2:121293984-121294006 TTGGTACAGCAGATGGGGCCTGG - Intergenic
937430448 2:121833487-121833509 TTCATTGCACAGATGAGGCACGG + Intergenic
938631715 2:133174721-133174743 TTGATTCCAAAGCTGGAGCAGGG - Intronic
941172982 2:162162497-162162519 GTGGAACTACAGATGGGGCAGGG - Intergenic
941497820 2:166228823-166228845 TTAACACCACAGATGGGTCACGG - Exonic
941928516 2:170918539-170918561 ATGATACAGCAGAGGGGGCAAGG + Intergenic
942757618 2:179360950-179360972 TGGTTACCACATTTGGGGCAGGG - Intergenic
945485913 2:210395510-210395532 TTGATTCCAGAGCTGGGGAAGGG - Intergenic
946683152 2:222239203-222239225 TGGATTCCACAGATGGAGCGTGG - Intronic
1169271065 20:4199818-4199840 TTGACTCCACAGGTGGGGCTAGG - Intergenic
1169895259 20:10498418-10498440 TAGATACCACAGACCTGGCAGGG - Intronic
1169895268 20:10498456-10498478 TAGATACCACAGAACTGGCAGGG - Intronic
1170561567 20:17563085-17563107 CTCATCCCACAGATGGGGTAAGG - Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1175777901 20:61664391-61664413 CAGAAACCACAGCTGGGGCATGG + Intronic
1177364571 21:20117443-20117465 TCGATGCTACTGATGGGGCATGG - Intergenic
1182200556 22:28564774-28564796 TTGATAGCAGAGGTGGGGCCAGG - Intronic
949567728 3:5260480-5260502 ATGATATCACAGATTGGGCCTGG - Intergenic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
952881951 3:37990983-37991005 GTGAAAACACTGATGGGGCAGGG + Intronic
960057414 3:113285248-113285270 GTGAGAGCTCAGATGGGGCAAGG - Intronic
960387263 3:117035399-117035421 TGGAGACCACAAAAGGGGCAAGG + Intronic
962884036 3:139606984-139607006 TTGATTCCAGGGCTGGGGCAGGG - Intronic
963071207 3:141306854-141306876 TGGAGACCACAGATAGGGAAGGG - Intergenic
972445301 4:39137665-39137687 CTGATTCCAGAGCTGGGGCATGG + Intergenic
976583093 4:86763016-86763038 TGGATATTACAGATGGGGAAGGG - Exonic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
984879086 4:184394778-184394800 CTGATGCCACAGATCAGGCAAGG + Intronic
987670704 5:21003753-21003775 TTGAGATCACAGATTGGGTAGGG - Intergenic
988094460 5:26586034-26586056 TTGTTACCAGAGATTAGGCAGGG - Intergenic
989036504 5:37178323-37178345 TTGTTACAACAGATAGGGCACGG + Intronic
990678475 5:58215318-58215340 TTGAGACCACAGCTGGGAAAAGG + Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991144870 5:63289300-63289322 TTGATTCCAGAGATGGGGCACGG - Intergenic
995781814 5:115784540-115784562 TTGACACCCTAGATGGGGCCTGG - Intergenic
995795524 5:115937141-115937163 CTGATACTAGAGCTGGGGCAGGG + Intergenic
997028540 5:130095321-130095343 TTGATTCCAGGGCTGGGGCAGGG + Intronic
997836733 5:137200330-137200352 TTGATATTTCAGATGGGGCCAGG - Intronic
998402135 5:141853528-141853550 TTGTTACCAAAGGTGGGGTAGGG - Exonic
998548355 5:143051672-143051694 TTTATAGCACTGATGAGGCAAGG - Intronic
999675715 5:154000177-154000199 GTGATACCAGAAATGGGGAAAGG + Intronic
999941410 5:156547279-156547301 TTGTCACAACAGAGGGGGCAGGG - Intronic
1000516523 5:162241654-162241676 TTGATACAGGAGAGGGGGCAGGG - Intergenic
1001284261 5:170410920-170410942 TGAATTCCACAGGTGGGGCATGG - Intronic
1001591068 5:172865747-172865769 TGAATCCCACAGATGGGACATGG - Intronic
1001700732 5:173704995-173705017 TTGTCACCCCTGATGGGGCAAGG - Intergenic
1003167371 6:3692521-3692543 CTGATTCCAGAGCTGGGGCAGGG + Intergenic
1006004613 6:30992401-30992423 TAAACACCACATATGGGGCAGGG - Intergenic
1007952799 6:45886964-45886986 ATGATGCCAGAGAGGGGGCATGG + Intergenic
1009295742 6:61944479-61944501 TAGATACCACAGGTAGGGAAGGG + Intronic
1009354902 6:62731210-62731232 TTGAAATCAAAGAAGGGGCATGG + Intergenic
1011449823 6:87480875-87480897 TTTGTACCACAGAAGGGGGATGG - Intronic
1013282894 6:108655557-108655579 TTGATTCAATAGATGGGGTAAGG - Intronic
1013516744 6:110894338-110894360 TCTATACCCCAGATGGGGAATGG + Exonic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015629674 6:135219451-135219473 CTGATACCACAGATGTGGGCAGG + Intergenic
1015814240 6:137191684-137191706 TTGGTACCAGAGATGGTGAAGGG + Intergenic
1017638669 6:156468560-156468582 TTGTGTCCACAGATGGGGCCTGG - Intergenic
1017706991 6:157132604-157132626 TGCATCCCACAGATTGGGCAGGG + Intronic
1017818744 6:158033688-158033710 TTGGTGCCACAGATGGGCCTGGG - Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019962693 7:4474026-4474048 TTGCCACCACTGATGGGTCAGGG - Intergenic
1024032905 7:45479888-45479910 CTGATTCCAGAGCTGGGGCAGGG + Intergenic
1026906018 7:74063230-74063252 TTGAAACCCCAGGAGGGGCAGGG + Intronic
1027950331 7:84807313-84807335 TTGACACCTGAGATGGGGAAAGG + Intergenic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1032239187 7:130148077-130148099 TGGAAACCACAGCTGGGGCTTGG - Intergenic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1033663322 7:143418691-143418713 TGCAGAACACAGATGGGGCAAGG + Intergenic
1035735179 8:1882393-1882415 ATAATACCATAAATGGGGCAGGG + Intronic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1037619472 8:20550848-20550870 ATGGTGCCACAGATGGTGCAGGG - Intergenic
1037846209 8:22284641-22284663 TTCACACCACTGATGGGGGAGGG - Intronic
1039379749 8:37074143-37074165 TGAATACCAGAGCTGGGGCAAGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042461013 8:69068667-69068689 TAGATATCACAGCAGGGGCATGG - Intergenic
1045654401 8:104371958-104371980 TTCATATCACAGATGAGGAAAGG - Intronic
1052371169 9:27666035-27666057 TTGATTCCAAGGCTGGGGCAAGG - Intergenic
1052494309 9:29208319-29208341 TTGATAACAAAGAGGCGGCAAGG - Intergenic
1053120201 9:35540563-35540585 TTGAGACCATGAATGGGGCAGGG + Intronic
1056698709 9:88883569-88883591 TTCATACCACAGATGAGGGATGG - Intergenic
1057896661 9:98914625-98914647 TTGATACCAGAGACTGGGAAGGG - Intergenic
1058241572 9:102568918-102568940 CTGACACCACAGATGCTGCAGGG + Intergenic
1060016453 9:120090646-120090668 TTGCTCCCAAAGATGGGGAATGG - Intergenic
1061625775 9:131839827-131839849 TGGAAACCAAAGATGGGGCTGGG + Intergenic
1062125615 9:134860092-134860114 TAGATACCAAAGTTGAGGCATGG + Intergenic
1186421949 X:9433422-9433444 TTGATAACACTGCTGGGGGAGGG + Intergenic
1187735433 X:22298560-22298582 TTAATACCAGGGATGGGGGAAGG + Intergenic
1187764384 X:22623608-22623630 TTGATTCCAGGGATGGGGCAGGG + Intergenic
1191641453 X:63432561-63432583 TTGATACCACAGATGAGGCAAGG + Intergenic
1192873972 X:75209682-75209704 TTGATACCACAGATAGGGTAAGG + Intergenic
1194142305 X:90221309-90221331 TTGATGCCATGGATGGGGTAAGG + Intergenic
1195121235 X:101755124-101755146 CTGGTACCTCAGATGGTGCAGGG - Intergenic
1195779413 X:108444540-108444562 CTGATTCCAGAGTTGGGGCAAGG - Intronic
1198270031 X:135048056-135048078 TTGATGCCAGAGATGGAGTAGGG - Intergenic
1198684262 X:139211076-139211098 GTTATACCACAGGTTGGGCATGG - Intronic
1198706660 X:139456305-139456327 CTGATTCCAGAGTTGGGGCACGG - Intergenic
1199034110 X:143031509-143031531 TTGATAACACAGATGGGGCGAGG + Intronic
1199074313 X:143511755-143511777 TTGATATCACAGATGGGGCAAGG - Intronic
1199215021 X:145253144-145253166 TTGATACCACAGATGGGGCAAGG + Intronic
1200488058 Y:3790410-3790432 TTGATGCCATGGATGGGGTAAGG + Intergenic
1202039434 Y:20666919-20666941 TTTATATCACAGATAGGGTAAGG - Intergenic