ID: 1199215892

View in Genome Browser
Species Human (GRCh38)
Location X:145259971-145259993
Sequence TGTGAAATGCATAGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199215892_1199215897 7 Left 1199215892 X:145259971-145259993 CCCTCCTTCCTATGCATTTCACA No data
Right 1199215897 X:145260001-145260023 CTCCTAAATCACTGCCTTATGGG No data
1199215892_1199215899 13 Left 1199215892 X:145259971-145259993 CCCTCCTTCCTATGCATTTCACA No data
Right 1199215899 X:145260007-145260029 AATCACTGCCTTATGGGAAGAGG No data
1199215892_1199215896 6 Left 1199215892 X:145259971-145259993 CCCTCCTTCCTATGCATTTCACA No data
Right 1199215896 X:145260000-145260022 TCTCCTAAATCACTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199215892 Original CRISPR TGTGAAATGCATAGGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr