ID: 1199221869

View in Genome Browser
Species Human (GRCh38)
Location X:145325985-145326007
Sequence GCTATTTGACGTGCTTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199221864_1199221869 23 Left 1199221864 X:145325939-145325961 CCTATGAGATGTTTGCAAATTTG No data
Right 1199221869 X:145325985-145326007 GCTATTTGACGTGCTTGCTCTGG No data
1199221866_1199221869 -1 Left 1199221866 X:145325963-145325985 CCCAAGCAGAGGCCTGAAAATTG No data
Right 1199221869 X:145325985-145326007 GCTATTTGACGTGCTTGCTCTGG No data
1199221867_1199221869 -2 Left 1199221867 X:145325964-145325986 CCAAGCAGAGGCCTGAAAATTGC No data
Right 1199221869 X:145325985-145326007 GCTATTTGACGTGCTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199221869 Original CRISPR GCTATTTGACGTGCTTGCTC TGG Intergenic
No off target data available for this crispr