ID: 1199231578

View in Genome Browser
Species Human (GRCh38)
Location X:145442642-145442664
Sequence TCAGATGGGTATATATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199231578_1199231584 9 Left 1199231578 X:145442642-145442664 CCCCAAAATATATACCCATCTGA No data
Right 1199231584 X:145442674-145442696 ATGACAGTGATGGAGTCCAATGG No data
1199231578_1199231586 11 Left 1199231578 X:145442642-145442664 CCCCAAAATATATACCCATCTGA No data
Right 1199231586 X:145442676-145442698 GACAGTGATGGAGTCCAATGGGG No data
1199231578_1199231585 10 Left 1199231578 X:145442642-145442664 CCCCAAAATATATACCCATCTGA No data
Right 1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG No data
1199231578_1199231583 -1 Left 1199231578 X:145442642-145442664 CCCCAAAATATATACCCATCTGA No data
Right 1199231583 X:145442664-145442686 ATTTTCAATAATGACAGTGATGG No data
1199231578_1199231587 12 Left 1199231578 X:145442642-145442664 CCCCAAAATATATACCCATCTGA No data
Right 1199231587 X:145442677-145442699 ACAGTGATGGAGTCCAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199231578 Original CRISPR TCAGATGGGTATATATTTTG GGG (reversed) Intergenic