ID: 1199231581

View in Genome Browser
Species Human (GRCh38)
Location X:145442656-145442678
Sequence GTCATTATTGAAAATCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199231581_1199231584 -5 Left 1199231581 X:145442656-145442678 CCCATCTGATTTTCAATAATGAC No data
Right 1199231584 X:145442674-145442696 ATGACAGTGATGGAGTCCAATGG No data
1199231581_1199231585 -4 Left 1199231581 X:145442656-145442678 CCCATCTGATTTTCAATAATGAC No data
Right 1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG No data
1199231581_1199231586 -3 Left 1199231581 X:145442656-145442678 CCCATCTGATTTTCAATAATGAC No data
Right 1199231586 X:145442676-145442698 GACAGTGATGGAGTCCAATGGGG No data
1199231581_1199231587 -2 Left 1199231581 X:145442656-145442678 CCCATCTGATTTTCAATAATGAC No data
Right 1199231587 X:145442677-145442699 ACAGTGATGGAGTCCAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199231581 Original CRISPR GTCATTATTGAAAATCAGAT GGG (reversed) Intergenic