ID: 1199231585

View in Genome Browser
Species Human (GRCh38)
Location X:145442675-145442697
Sequence TGACAGTGATGGAGTCCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199231581_1199231585 -4 Left 1199231581 X:145442656-145442678 CCCATCTGATTTTCAATAATGAC No data
Right 1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG No data
1199231579_1199231585 9 Left 1199231579 X:145442643-145442665 CCCAAAATATATACCCATCTGAT No data
Right 1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG No data
1199231580_1199231585 8 Left 1199231580 X:145442644-145442666 CCAAAATATATACCCATCTGATT No data
Right 1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG No data
1199231582_1199231585 -5 Left 1199231582 X:145442657-145442679 CCATCTGATTTTCAATAATGACA No data
Right 1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG No data
1199231578_1199231585 10 Left 1199231578 X:145442642-145442664 CCCCAAAATATATACCCATCTGA No data
Right 1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199231585 Original CRISPR TGACAGTGATGGAGTCCAAT GGG Intergenic