ID: 1199236290

View in Genome Browser
Species Human (GRCh38)
Location X:145498118-145498140
Sequence TGCAGAGGGTTTTGGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199236277_1199236290 10 Left 1199236277 X:145498085-145498107 CCACTCCTCCATCCCCAGGCAAA No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236282_1199236290 2 Left 1199236282 X:145498093-145498115 CCATCCCCAGGCAAATGGGGAAT No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236284_1199236290 -2 Left 1199236284 X:145498097-145498119 CCCCAGGCAAATGGGGAATGGTG No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236286_1199236290 -4 Left 1199236286 X:145498099-145498121 CCAGGCAAATGGGGAATGGTGCA No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236285_1199236290 -3 Left 1199236285 X:145498098-145498120 CCCAGGCAAATGGGGAATGGTGC No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236280_1199236290 5 Left 1199236280 X:145498090-145498112 CCTCCATCCCCAGGCAAATGGGG No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236274_1199236290 19 Left 1199236274 X:145498076-145498098 CCAATGCCACCACTCCTCCATCC No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236276_1199236290 13 Left 1199236276 X:145498082-145498104 CCACCACTCCTCCATCCCCAGGC No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data
1199236273_1199236290 20 Left 1199236273 X:145498075-145498097 CCCAATGCCACCACTCCTCCATC No data
Right 1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199236290 Original CRISPR TGCAGAGGGTTTTGGTGTAC TGG Intergenic
No off target data available for this crispr