ID: 1199239205

View in Genome Browser
Species Human (GRCh38)
Location X:145526767-145526789
Sequence GACTACTGGATAGCAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199239200_1199239205 9 Left 1199239200 X:145526735-145526757 CCAGGTAGACTTCGAAGGTGTTT No data
Right 1199239205 X:145526767-145526789 GACTACTGGATAGCAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199239205 Original CRISPR GACTACTGGATAGCAGCTCT GGG Intergenic
No off target data available for this crispr