ID: 1199239603

View in Genome Browser
Species Human (GRCh38)
Location X:145530709-145530731
Sequence CGCATATTAATTCTTTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199239603_1199239606 -7 Left 1199239603 X:145530709-145530731 CCCTGGTAAAGAATTAATATGCG No data
Right 1199239606 X:145530725-145530747 ATATGCGGAGTCCTGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199239603 Original CRISPR CGCATATTAATTCTTTACCA GGG (reversed) Intergenic
No off target data available for this crispr