ID: 1199239605

View in Genome Browser
Species Human (GRCh38)
Location X:145530710-145530732
Sequence CCTGGTAAAGAATTAATATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199239599_1199239605 7 Left 1199239599 X:145530680-145530702 CCTGCAGATTTCTAGGCCTCCAA No data
Right 1199239605 X:145530710-145530732 CCTGGTAAAGAATTAATATGCGG No data
1199239595_1199239605 19 Left 1199239595 X:145530668-145530690 CCCTGCCTCAAGCCTGCAGATTT No data
Right 1199239605 X:145530710-145530732 CCTGGTAAAGAATTAATATGCGG No data
1199239601_1199239605 -9 Left 1199239601 X:145530696-145530718 CCTCCAATTTGATCCCTGGTAAA No data
Right 1199239605 X:145530710-145530732 CCTGGTAAAGAATTAATATGCGG No data
1199239596_1199239605 18 Left 1199239596 X:145530669-145530691 CCTGCCTCAAGCCTGCAGATTTC No data
Right 1199239605 X:145530710-145530732 CCTGGTAAAGAATTAATATGCGG No data
1199239597_1199239605 14 Left 1199239597 X:145530673-145530695 CCTCAAGCCTGCAGATTTCTAGG No data
Right 1199239605 X:145530710-145530732 CCTGGTAAAGAATTAATATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199239605 Original CRISPR CCTGGTAAAGAATTAATATG CGG Intergenic
No off target data available for this crispr