ID: 1199239606

View in Genome Browser
Species Human (GRCh38)
Location X:145530725-145530747
Sequence ATATGCGGAGTCCTGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199239599_1199239606 22 Left 1199239599 X:145530680-145530702 CCTGCAGATTTCTAGGCCTCCAA No data
Right 1199239606 X:145530725-145530747 ATATGCGGAGTCCTGTAGAGAGG No data
1199239604_1199239606 -8 Left 1199239604 X:145530710-145530732 CCTGGTAAAGAATTAATATGCGG No data
Right 1199239606 X:145530725-145530747 ATATGCGGAGTCCTGTAGAGAGG No data
1199239603_1199239606 -7 Left 1199239603 X:145530709-145530731 CCCTGGTAAAGAATTAATATGCG No data
Right 1199239606 X:145530725-145530747 ATATGCGGAGTCCTGTAGAGAGG No data
1199239597_1199239606 29 Left 1199239597 X:145530673-145530695 CCTCAAGCCTGCAGATTTCTAGG No data
Right 1199239606 X:145530725-145530747 ATATGCGGAGTCCTGTAGAGAGG No data
1199239601_1199239606 6 Left 1199239601 X:145530696-145530718 CCTCCAATTTGATCCCTGGTAAA No data
Right 1199239606 X:145530725-145530747 ATATGCGGAGTCCTGTAGAGAGG No data
1199239602_1199239606 3 Left 1199239602 X:145530699-145530721 CCAATTTGATCCCTGGTAAAGAA No data
Right 1199239606 X:145530725-145530747 ATATGCGGAGTCCTGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199239606 Original CRISPR ATATGCGGAGTCCTGTAGAG AGG Intergenic
No off target data available for this crispr