ID: 1199243449

View in Genome Browser
Species Human (GRCh38)
Location X:145575147-145575169
Sequence CTTGAGCCATAGCTAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199243449_1199243459 10 Left 1199243449 X:145575147-145575169 CCCAGCTCTAGCTATGGCTCAAG No data
Right 1199243459 X:145575180-145575202 TACAGATCAGGCTGCTGTTTTGG No data
1199243449_1199243455 -2 Left 1199243449 X:145575147-145575169 CCCAGCTCTAGCTATGGCTCAAG No data
Right 1199243455 X:145575168-145575190 AGGGGCCCCAGGTACAGATCAGG No data
1199243449_1199243460 13 Left 1199243449 X:145575147-145575169 CCCAGCTCTAGCTATGGCTCAAG No data
Right 1199243460 X:145575183-145575205 AGATCAGGCTGCTGTTTTGGAGG No data
1199243449_1199243461 14 Left 1199243449 X:145575147-145575169 CCCAGCTCTAGCTATGGCTCAAG No data
Right 1199243461 X:145575184-145575206 GATCAGGCTGCTGTTTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199243449 Original CRISPR CTTGAGCCATAGCTAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr