ID: 1199245045

View in Genome Browser
Species Human (GRCh38)
Location X:145593953-145593975
Sequence GTTCAGCAGCAGCATGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199245044_1199245045 -7 Left 1199245044 X:145593937-145593959 CCAAATCAAAGTGGCTGTTCAGC No data
Right 1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199245045 Original CRISPR GTTCAGCAGCAGCATGCTAT AGG Intergenic
No off target data available for this crispr