ID: 1199248153

View in Genome Browser
Species Human (GRCh38)
Location X:145630924-145630946
Sequence CGGTGCTGGCGCGGAACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199248148_1199248153 -8 Left 1199248148 X:145630909-145630931 CCCGCACGGACACGGCGGTGCTG 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1199248153 X:145630924-145630946 CGGTGCTGGCGCGGAACAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 35
1199248149_1199248153 -9 Left 1199248149 X:145630910-145630932 CCGCACGGACACGGCGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1199248153 X:145630924-145630946 CGGTGCTGGCGCGGAACAGTGGG 0: 1
1: 0
2: 1
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199248153 Original CRISPR CGGTGCTGGCGCGGAACAGT GGG Intergenic
900393586 1:2444120-2444142 GGGTGCGGGCGCGGGACTGTGGG + Intronic
904415914 1:30361127-30361149 AGCTGCTGGCCAGGAACAGTAGG + Intergenic
904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG + Intergenic
905337938 1:37258181-37258203 CGGTGCTGGGGCTGGAGAGTGGG - Intergenic
1065024543 10:21527347-21527369 CGGTGCTAGGGCAGAACAATGGG - Intergenic
1077573294 11:3357032-3357054 CGGTGCTGTTGGGGAAAAGTTGG + Intronic
1084000847 11:66294647-66294669 CGGTGCTGGCGCTGATCCGCCGG + Exonic
1101247837 12:102901875-102901897 AGGTGCTGGAGTGTAACAGTGGG + Intronic
1103596422 12:122026915-122026937 CCGTGCTGGGGAGGAGCAGTTGG + Intronic
1111647327 13:91047157-91047179 CGGAGCTGGCAAGGAACAGAAGG + Intergenic
1113931862 13:113972912-113972934 CGCTGCTGGGGCGGAGCTGTGGG - Intergenic
1113938716 13:114007770-114007792 CGGGGCTGGGGTGGCACAGTGGG - Intronic
1118771118 14:68943440-68943462 CGGTGCTGGTGGGCAACAGCAGG - Intronic
1124922202 15:34038545-34038567 CCGGGCTGGCGCGAGACAGTGGG - Intronic
1127075217 15:55318933-55318955 TGGAGCAGGCGCAGAACAGTCGG - Exonic
1132365060 15:101251321-101251343 CGGGGCTGGCGCGGCGCCGTGGG + Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1134208104 16:12253894-12253916 CGGTGGTGGCTGGGACCAGTTGG + Intronic
1152656069 17:81519708-81519730 CAGGGCTGACGCGGAAAAGTGGG + Intronic
1152732151 17:81977684-81977706 CGGTGCTGGCCCCGAACGGCCGG + Exonic
1154981010 18:21502322-21502344 CTGTGCTGGCAGGGAACTGTGGG + Intronic
1162801409 19:13112765-13112787 CGGTGTTGGCGGGGAACAGCGGG - Exonic
945285543 2:208078106-208078128 CGGTGCTGTCGAGGAGCACTGGG + Intergenic
1171230618 20:23481131-23481153 CTGTGCTTGTCCGGAACAGTAGG - Intergenic
1180085836 21:45507466-45507488 AGGTGCTGGGGCGGGAGAGTCGG + Intronic
1184954565 22:47877131-47877153 CGGTGGTGGCCCGGACCAGATGG - Intergenic
963600147 3:147371768-147371790 CAGGGCTGGCGCTGAAAAGTGGG - Intergenic
985421834 4:189792299-189792321 CCGTGCTGGAGCTGACCAGTGGG - Intergenic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
994075619 5:95646617-95646639 AGGTGCTGGCGCGGCGCTGTTGG + Intergenic
998331561 5:141332276-141332298 AAGTGATGGCGCGGGACAGTGGG + Exonic
1013753224 6:113431289-113431311 TGGTGCTGCCTAGGAACAGTAGG - Intergenic
1014724825 6:124962160-124962182 CGGTGATGGCGCGGGACTGACGG + Intergenic
1032369050 7:131328027-131328049 CCGTGCTGACGCGGAAGGGTGGG - Intronic
1035650133 8:1257690-1257712 CAGTGCTGGCGTGGAAGAGCCGG + Intergenic
1043291988 8:78613378-78613400 CGGTATTGGCGAGGAACAGGTGG + Intergenic
1056475227 9:86946537-86946559 CGGTGCTGGCGCAGCACGGCGGG - Exonic
1199248153 X:145630924-145630946 CGGTGCTGGCGCGGAACAGTGGG + Intergenic