ID: 1199263728

View in Genome Browser
Species Human (GRCh38)
Location X:145805892-145805914
Sequence GCCCTCAATTGCCTACCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199263728_1199263732 6 Left 1199263728 X:145805892-145805914 CCCACAGGTAGGCAATTGAGGGC No data
Right 1199263732 X:145805921-145805943 GATGGTTCTACATGGTCCTTAGG No data
1199263728_1199263735 24 Left 1199263728 X:145805892-145805914 CCCACAGGTAGGCAATTGAGGGC No data
Right 1199263735 X:145805939-145805961 TTAGGGACCCCAGCATGTTCTGG No data
1199263728_1199263731 -2 Left 1199263728 X:145805892-145805914 CCCACAGGTAGGCAATTGAGGGC No data
Right 1199263731 X:145805913-145805935 GCTACTATGATGGTTCTACATGG No data
1199263728_1199263733 7 Left 1199263728 X:145805892-145805914 CCCACAGGTAGGCAATTGAGGGC No data
Right 1199263733 X:145805922-145805944 ATGGTTCTACATGGTCCTTAGGG No data
1199263728_1199263736 25 Left 1199263728 X:145805892-145805914 CCCACAGGTAGGCAATTGAGGGC No data
Right 1199263736 X:145805940-145805962 TAGGGACCCCAGCATGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199263728 Original CRISPR GCCCTCAATTGCCTACCTGT GGG (reversed) Intergenic
No off target data available for this crispr