ID: 1199263731

View in Genome Browser
Species Human (GRCh38)
Location X:145805913-145805935
Sequence GCTACTATGATGGTTCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199263728_1199263731 -2 Left 1199263728 X:145805892-145805914 CCCACAGGTAGGCAATTGAGGGC No data
Right 1199263731 X:145805913-145805935 GCTACTATGATGGTTCTACATGG No data
1199263729_1199263731 -3 Left 1199263729 X:145805893-145805915 CCACAGGTAGGCAATTGAGGGCT No data
Right 1199263731 X:145805913-145805935 GCTACTATGATGGTTCTACATGG No data
1199263723_1199263731 27 Left 1199263723 X:145805863-145805885 CCTAAAATAAAAGTTAACATAAA No data
Right 1199263731 X:145805913-145805935 GCTACTATGATGGTTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199263731 Original CRISPR GCTACTATGATGGTTCTACA TGG Intergenic
No off target data available for this crispr