ID: 1199263736

View in Genome Browser
Species Human (GRCh38)
Location X:145805940-145805962
Sequence TAGGGACCCCAGCATGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199263729_1199263736 24 Left 1199263729 X:145805893-145805915 CCACAGGTAGGCAATTGAGGGCT No data
Right 1199263736 X:145805940-145805962 TAGGGACCCCAGCATGTTCTGGG No data
1199263728_1199263736 25 Left 1199263728 X:145805892-145805914 CCCACAGGTAGGCAATTGAGGGC No data
Right 1199263736 X:145805940-145805962 TAGGGACCCCAGCATGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199263736 Original CRISPR TAGGGACCCCAGCATGTTCT GGG Intergenic
No off target data available for this crispr